Pd9718nr Pd9718nr

01-02-2017
Chemistry

contestada

round each number to three significant figures 1044.987

Respuesta :

01-02-2017

If we rounded to three sig figs: 1040

Answer Link

Otras preguntas

Mara lives in st. Louis, which is close to sea level. She decides to spend a month of her summer vacation working in the mountains outside of denver. After a we

what does burned ether mean, and when ether is burned, does it increase the value of your glk balance

Change the DNA to show 3 examples of wobble. Include the mRNA sequence and amino acid chain. CGTAGATCGATCGATCGCTGACTACGATCGACTGCTCGTCAGATAACGTACGTA

A circle is centered on point B, Points A, C and D lie on its circumference. if ABC measures 61 degrees, what does ADC measures?

a what is a retail department store that sells at prices 25 percent or more below traditional department store prices in no frills environments, but does not se

) a ring and a disk of equal mass and radius are rolled down a ramp. a) which has a greater rotational inertia? b) which will reach the bottom first?

Morgan has 98 baseball cards in his collection, which is twelve less than the product of 5 and the number of cards Tyler has.

A company is having a contest for the best way to reduce energy use. All ideas must be in the form of a written report. How will it help the company to have rep

is there something wrong with the nuclear model (like a miniature solar system) of the atom? if so, what is wrong? choose all that apply.

zhen troubleshoots and repairs computers and networks for individuals and small businesses. which statement best describes what zhen offers to customers? a) a p

Q&A Education